algorithms maxquant software mpi biochemistry martinsried (Addgene inc)
Addgene inc is a verified supplier 
90
Structured Review
Addgene inc
algorithms maxquant software mpi biochemistry martinsried
Algorithms Maxquant Software Mpi Biochemistry Martinsried, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+maxquant+software+mpi+biochemistry+martinsried/PLPBP_pDEST007+(Plasmid+%23131231)/pmc06876276__mmc4-151-70-67
Average 90 stars, based on 1 article reviews
Algorithms Maxquant Software Mpi Biochemistry Martinsried, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+maxquant+software+mpi+biochemistry+martinsried/PLPBP_pDEST007+(Plasmid+%23131231)/pmc06876276__mmc4-151-70-67
Average 90 stars, based on 1 article reviews
algorithms maxquant software mpi biochemistry martinsried - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Recombinant:Article Title: Customizing Functionalized Cofactor Mimics to Study the Human Pyridoxal 5′-Phosphate-Binding Proteome Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-PLPBP antibody (clone 1G2) OriGene Cat# TA505162; RRID: AB_2622886 Rabbit polyclonal anti-SHMT2 antibody abbexxa Cat# abx128462 Rabbit polyclonal anti-PNPO antibody Sigma Cat# HPA023204; RRID: AB_1855506 Rabbit polyclonal anti-ALAS1 antibody Thermo Fisher Scientific Cat# PA5-57434; RRID: AB_2637832 Rabbit polyclonal anti-SHMT1 antibody abcam Cat# ab55736; RRID: AB_2285970 Goat anti-rabbit antibody conjugated to horseradish peroxidase invitrogen Cat# 32260 Goat anti-mouse antibody conjugated to horseradish peroxidase invitrogen Cat# 32230 Mouse monoclonal anti-PLK antibody Santa Cruz Biotechnology, Inc. Cat# sc-365173, RRID: AB_10708566 Rabbit polyclonal anti-PL antibody GeneTex Cat# GTX12625 Bacterial and Virus Strains Escherichia coli Rosetta 2 (DE3) Merck Cat# 71400 Chemicals, Peptides, and Recombinant Proteins PL1 Hoegl et al., 2018 N/A PL2 Hoegl et al., 2018 N/A PL3 Hoegl et al., 2018 N/A Glycosylceramidase (GBA) ProSpec Cat# enz-908 Lysyl Endopeptidase Wako Cat# 125-05061 Trypsin, Sequencing grade Promega Cat# V5111 L-Penicillamine TCI Cat# P1370 D-Penicillamine Acros Organics via Fisher Scientific Cat# 10224750 BTTAA ligand Jena Bioscience Cat# CLK-067-25 Critical Commercial Assays Roti Quant Universal Roth Cat# 0120.1 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 ECI western blotting substrate solution Pierce Cat# PIER80196 Ponceau S Sigma Cat# P3504 Deposited Data raw files, Fasta files, and MaxQuant analysis to PRIDE This manuscript https://www.ebi.ac.uk/pride/archive/; PXD014771 Experimental Models: Cell Lines Human HeLa cell line ECACC via Sigma Aldrich Cat# 93021013; RRID: CVCL_0030 Human K562 cell line ECACC via Sigma Aldrich Cat# 89121407; RRID: CVCL_0004 Human HCT116 cell line ECACC via Sigma Aldrich Cat# 91091005; RRID: CVCL_0291 Human HEK293 cell line ECACC via Sigma Aldrich Cat# 85120602; RRID: CVCL_0045 Oligonucleotides hPLK forward primer (5’->3’): ggggacaagtttgtacaaaaaa gcaggctttgagaatctttattttcagggcgaggaggagtgccgggtg eurofins custom made hPLK reverse primer (5’->3’): ggggaccactttgtacaagaaa gctgggtgtcacagcaccgtggcctgg eurofins custom made SHMT1 forward primer (5’->3’): ggggacaagtttgtacaaaaa agcaggCtttgagaatctttattttcagggcacgatgccagtcaacgggg eurofins custom made SHMT1 reverse primer (5’->3’): ggggaccactttgtacaagaaa gctgggtgtcagaagtcaggcaggccag eurofins custom made (Continued on next page) Cell Chemical Biology 26, 1461–1468.e1–e7, October 17, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER PLPBP forward primer (5’->3’): ggggacaagtttgtacaaaaaa gcagGctttgagaatctttattttcagggctggagagctggcagcatgtcg eurofins custom made PLPBP reverse primer (5’->3’): ggggaccactttgtacaagaaa gctgggtgtcagtgctcctgtgccacctc eurofins custom made Recombinant DNA Human cDNA library from HeLa BioAcademia Cat# 02-723 SHMT1 ORF clone, NM_004169 GeneScript Cat# OHu21374 PLPBP ORF clone, NM_007198.3 GeneScript Cat# OHu09065 SHMT1_pDest007 This manuscript Addgene ID: 131229 (http://www.addgene.org) hPLK_pDest007 This manuscript Addgene ID: 131230 (http://www.addgene.org) PLPBP_pDest007 This manuscript Addgene ID: cDNA Library Assay:Article Title: Customizing Functionalized Cofactor Mimics to Study the Human Pyridoxal 5′-Phosphate-Binding Proteome Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-PLPBP antibody (clone 1G2) OriGene Cat# TA505162; RRID: AB_2622886 Rabbit polyclonal anti-SHMT2 antibody abbexxa Cat# abx128462 Rabbit polyclonal anti-PNPO antibody Sigma Cat# HPA023204; RRID: AB_1855506 Rabbit polyclonal anti-ALAS1 antibody Thermo Fisher Scientific Cat# PA5-57434; RRID: AB_2637832 Rabbit polyclonal anti-SHMT1 antibody abcam Cat# ab55736; RRID: AB_2285970 Goat anti-rabbit antibody conjugated to horseradish peroxidase invitrogen Cat# 32260 Goat anti-mouse antibody conjugated to horseradish peroxidase invitrogen Cat# 32230 Mouse monoclonal anti-PLK antibody Santa Cruz Biotechnology, Inc. Cat# sc-365173, RRID: AB_10708566 Rabbit polyclonal anti-PL antibody GeneTex Cat# GTX12625 Bacterial and Virus Strains Escherichia coli Rosetta 2 (DE3) Merck Cat# 71400 Chemicals, Peptides, and Recombinant Proteins PL1 Hoegl et al., 2018 N/A PL2 Hoegl et al., 2018 N/A PL3 Hoegl et al., 2018 N/A Glycosylceramidase (GBA) ProSpec Cat# enz-908 Lysyl Endopeptidase Wako Cat# 125-05061 Trypsin, Sequencing grade Promega Cat# V5111 L-Penicillamine TCI Cat# P1370 D-Penicillamine Acros Organics via Fisher Scientific Cat# 10224750 BTTAA ligand Jena Bioscience Cat# CLK-067-25 Critical Commercial Assays Roti Quant Universal Roth Cat# 0120.1 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 ECI western blotting substrate solution Pierce Cat# PIER80196 Ponceau S Sigma Cat# P3504 Deposited Data raw files, Fasta files, and MaxQuant analysis to PRIDE This manuscript https://www.ebi.ac.uk/pride/archive/; PXD014771 Experimental Models: Cell Lines Human HeLa cell line ECACC via Sigma Aldrich Cat# 93021013; RRID: CVCL_0030 Human K562 cell line ECACC via Sigma Aldrich Cat# 89121407; RRID: CVCL_0004 Human HCT116 cell line ECACC via Sigma Aldrich Cat# 91091005; RRID: CVCL_0291 Human HEK293 cell line ECACC via Sigma Aldrich Cat# 85120602; RRID: CVCL_0045 Oligonucleotides hPLK forward primer (5’->3’): ggggacaagtttgtacaaaaaa gcaggctttgagaatctttattttcagggcgaggaggagtgccgggtg eurofins custom made hPLK reverse primer (5’->3’): ggggaccactttgtacaagaaa gctgggtgtcacagcaccgtggcctgg eurofins custom made SHMT1 forward primer (5’->3’): ggggacaagtttgtacaaaaa agcaggCtttgagaatctttattttcagggcacgatgccagtcaacgggg eurofins custom made SHMT1 reverse primer (5’->3’): ggggaccactttgtacaagaaa gctgggtgtcagaagtcaggcaggccag eurofins custom made (Continued on next page) Cell Chemical Biology 26, 1461–1468.e1–e7, October 17, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER PLPBP forward primer (5’->3’): ggggacaagtttgtacaaaaaa gcagGctttgagaatctttattttcagggctggagagctggcagcatgtcg eurofins custom made PLPBP reverse primer (5’->3’): ggggaccactttgtacaagaaa gctgggtgtcagtgctcctgtgccacctc eurofins custom made Recombinant DNA Human cDNA library from HeLa BioAcademia Cat# 02-723 SHMT1 ORF clone, NM_004169 GeneScript Cat# OHu21374 PLPBP ORF clone, NM_007198.3 GeneScript Cat# OHu09065 SHMT1_pDest007 This manuscript Addgene ID: 131229 (http://www.addgene.org) hPLK_pDest007 This manuscript Addgene ID: 131230 (http://www.addgene.org) PLPBP_pDest007 This manuscript Addgene ID: Software:Article Title: Customizing Functionalized Cofactor Mimics to Study the Human Pyridoxal 5′-Phosphate-Binding Proteome Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-PLPBP antibody (clone 1G2) OriGene Cat# TA505162; RRID: AB_2622886 Rabbit polyclonal anti-SHMT2 antibody abbexxa Cat# abx128462 Rabbit polyclonal anti-PNPO antibody Sigma Cat# HPA023204; RRID: AB_1855506 Rabbit polyclonal anti-ALAS1 antibody Thermo Fisher Scientific Cat# PA5-57434; RRID: AB_2637832 Rabbit polyclonal anti-SHMT1 antibody abcam Cat# ab55736; RRID: AB_2285970 Goat anti-rabbit antibody conjugated to horseradish peroxidase invitrogen Cat# 32260 Goat anti-mouse antibody conjugated to horseradish peroxidase invitrogen Cat# 32230 Mouse monoclonal anti-PLK antibody Santa Cruz Biotechnology, Inc. Cat# sc-365173, RRID: AB_10708566 Rabbit polyclonal anti-PL antibody GeneTex Cat# GTX12625 Bacterial and Virus Strains Escherichia coli Rosetta 2 (DE3) Merck Cat# 71400 Chemicals, Peptides, and Recombinant Proteins PL1 Hoegl et al., 2018 N/A PL2 Hoegl et al., 2018 N/A PL3 Hoegl et al., 2018 N/A Glycosylceramidase (GBA) ProSpec Cat# enz-908 Lysyl Endopeptidase Wako Cat# 125-05061 Trypsin, Sequencing grade Promega Cat# V5111 L-Penicillamine TCI Cat# P1370 D-Penicillamine Acros Organics via Fisher Scientific Cat# 10224750 BTTAA ligand Jena Bioscience Cat# CLK-067-25 Critical Commercial Assays Roti Quant Universal Roth Cat# 0120.1 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 ECI western blotting substrate solution Pierce Cat# PIER80196 Ponceau S Sigma Cat# P3504 Deposited Data raw files, Fasta files, and MaxQuant analysis to PRIDE This manuscript https://www.ebi.ac.uk/pride/archive/; PXD014771 Experimental Models: Cell Lines Human HeLa cell line ECACC via Sigma Aldrich Cat# 93021013; RRID: CVCL_0030 Human K562 cell line ECACC via Sigma Aldrich Cat# 89121407; RRID: CVCL_0004 Human HCT116 cell line ECACC via Sigma Aldrich Cat# 91091005; RRID: CVCL_0291 Human HEK293 cell line ECACC via Sigma Aldrich Cat# 85120602; RRID: CVCL_0045 Oligonucleotides hPLK forward primer (5’->3’): ggggacaagtttgtacaaaaaa gcaggctttgagaatctttattttcagggcgaggaggagtgccgggtg eurofins custom made hPLK reverse primer (5’->3’): ggggaccactttgtacaagaaa gctgggtgtcacagcaccgtggcctgg eurofins custom made SHMT1 forward primer (5’->3’): ggggacaagtttgtacaaaaa agcaggCtttgagaatctttattttcagggcacgatgccagtcaacgggg eurofins custom made SHMT1 reverse primer (5’->3’): ggggaccactttgtacaagaaa gctgggtgtcagaagtcaggcaggccag eurofins custom made (Continued on next page) Cell Chemical Biology 26, 1461–1468.e1–e7, October 17, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER PLPBP forward primer (5’->3’): ggggacaagtttgtacaaaaaa gcagGctttgagaatctttattttcagggctggagagctggcagcatgtcg eurofins custom made PLPBP reverse primer (5’->3’): ggggaccactttgtacaagaaa gctgggtgtcagtgctcctgtgccacctc eurofins custom made Recombinant DNA Human cDNA library from HeLa BioAcademia Cat# 02-723 SHMT1 ORF clone, NM_004169 GeneScript Cat# OHu21374 PLPBP ORF clone, NM_007198.3 GeneScript Cat# OHu09065 SHMT1_pDest007 This manuscript Addgene ID: 131229 (http://www.addgene.org) hPLK_pDest007 This manuscript Addgene ID: 131230 (http://www.addgene.org) PLPBP_pDest007 This manuscript Addgene ID: Staining:Article Title: Customizing Functionalized Cofactor Mimics to Study the Human Pyridoxal 5′-Phosphate-Binding Proteome Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-PLPBP antibody (clone 1G2) OriGene Cat# TA505162; RRID: AB_2622886 Rabbit polyclonal anti-SHMT2 antibody abbexxa Cat# abx128462 Rabbit polyclonal anti-PNPO antibody Sigma Cat# HPA023204; RRID: AB_1855506 Rabbit polyclonal anti-ALAS1 antibody Thermo Fisher Scientific Cat# PA5-57434; RRID: AB_2637832 Rabbit polyclonal anti-SHMT1 antibody abcam Cat# ab55736; RRID: AB_2285970 Goat anti-rabbit antibody conjugated to horseradish peroxidase invitrogen Cat# 32260 Goat anti-mouse antibody conjugated to horseradish peroxidase invitrogen Cat# 32230 Mouse monoclonal anti-PLK antibody Santa Cruz Biotechnology, Inc. Cat# sc-365173, RRID: AB_10708566 Rabbit polyclonal anti-PL antibody GeneTex Cat# GTX12625 Bacterial and Virus Strains Escherichia coli Rosetta 2 (DE3) Merck Cat# 71400 Chemicals, Peptides, and Recombinant Proteins PL1 Hoegl et al., 2018 N/A PL2 Hoegl et al., 2018 N/A PL3 Hoegl et al., 2018 N/A Glycosylceramidase (GBA) ProSpec Cat# enz-908 Lysyl Endopeptidase Wako Cat# 125-05061 Trypsin, Sequencing grade Promega Cat# V5111 L-Penicillamine TCI Cat# P1370 D-Penicillamine Acros Organics via Fisher Scientific Cat# 10224750 BTTAA ligand Jena Bioscience Cat# CLK-067-25 Critical Commercial Assays Roti Quant Universal Roth Cat# 0120.1 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 ECI western blotting substrate solution Pierce Cat# PIER80196 Ponceau S Sigma Cat# P3504 Deposited Data raw files, Fasta files, and MaxQuant analysis to PRIDE This manuscript https://www.ebi.ac.uk/pride/archive/; PXD014771 Experimental Models: Cell Lines Human HeLa cell line ECACC via Sigma Aldrich Cat# 93021013; RRID: CVCL_0030 Human K562 cell line ECACC via Sigma Aldrich Cat# 89121407; RRID: CVCL_0004 Human HCT116 cell line ECACC via Sigma Aldrich Cat# 91091005; RRID: CVCL_0291 Human HEK293 cell line ECACC via Sigma Aldrich Cat# 85120602; RRID: CVCL_0045 Oligonucleotides hPLK forward primer (5’->3’): ggggacaagtttgtacaaaaaa gcaggctttgagaatctttattttcagggcgaggaggagtgccgggtg eurofins custom made hPLK reverse primer (5’->3’): ggggaccactttgtacaagaaa gctgggtgtcacagcaccgtggcctgg eurofins custom made SHMT1 forward primer (5’->3’): ggggacaagtttgtacaaaaa agcaggCtttgagaatctttattttcagggcacgatgccagtcaacgggg eurofins custom made SHMT1 reverse primer (5’->3’): ggggaccactttgtacaagaaa gctgggtgtcagaagtcaggcaggccag eurofins custom made (Continued on next page) Cell Chemical Biology 26, 1461–1468.e1–e7, October 17, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER PLPBP forward primer (5’->3’): ggggacaagtttgtacaaaaaa gcagGctttgagaatctttattttcagggctggagagctggcagcatgtcg eurofins custom made PLPBP reverse primer (5’->3’): ggggaccactttgtacaagaaa gctgggtgtcagtgctcctgtgccacctc eurofins custom made Recombinant DNA Human cDNA library from HeLa BioAcademia Cat# 02-723 SHMT1 ORF clone, NM_004169 GeneScript Cat# OHu21374 PLPBP ORF clone, NM_007198.3 GeneScript Cat# OHu09065 SHMT1_pDest007 This manuscript Addgene ID: 131229 (http://www.addgene.org) hPLK_pDest007 This manuscript Addgene ID: 131230 (http://www.addgene.org) PLPBP_pDest007 This manuscript Addgene ID: |